Former UCSD prof who resigned amid investigation into China ties has paper flagged for using the wrong test

Kang Zhang

Science Translational Medicine has issued an expression of concern about a 2020 paper on the genetics of colorectal cancer by a group in China whose results were pegged on a test that couldn’t have produced the findings. 

The article, “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer,” appeared in January, with authors from both academia and an outfit called the Guangzhou Youze Biological Pharmaceutical Technology Company. 

One member of the group is Kang Zhang, who resigned his post at the University of California, San Diego last year after reports of undisclosed ties to China. In March, as we reported, Zhang retracted a paper from PNAS because some of its images were taken from other researchers’ work.

In 2012, according to inewsource, Zhang — whose affiliations are listed as Sichuan University and the Macau University of Science and Technology, the latter of which was listed on his now-retracted PNAS paper  —  founded the Guangzhou Kangrui Biological Pharmaceutical Technology Co., which appears to be the same entity as Guangzhou Youze. 

The abstract of the Science Translational Medicine article reads: 

Circulating tumor DNA (ctDNA) has emerged as a useful diagnostic and prognostic biomarker in many cancers. Here, we conducted a study to investigate the potential use of ctDNA methylation markers for the diagnosis and prognostication of colorectal cancer (CRC) and used a prospective cohort to validate their effectiveness in screening patients at high risk of CRC. We first identified CRC-specific methylation signatures by comparing CRC tissues to normal blood leukocytes. Then, we applied a machine learning algorithm to develop a predictive diagnostic and a prognostic model using cell-free DNA (cfDNA) samples from a cohort of 801 patients with CRC and 1021 normal controls. The obtained diagnostic prediction model discriminated patients with CRC from normal controls with high accuracy (area under curve = 0.96). The prognostic prediction model also effectively predicted the prognosis and survival of patients with CRC (P < 0.001). In addition, we generated a ctDNA-based molecular classification of CRC using an unsupervised clustering method and obtained two subgroups of patients with CRC with significantly different overall survival (P = 0.011 in validation cohort). Last, we found that a single ctDNA methylation marker, cg10673833, could yield high sensitivity (89.7%) and specificity (86.8%) for detection of CRC and precancerous lesions in a high-risk population of 1493 participants in a prospective cohort study. Together, our findings showed the value of ctDNA methylation markers in the diagnosis, surveillance, and prognosis of CRC.

Or, as the journal put it in a summary of the paper titled “Methylation marks the spot”: 

The detection of circulating tumor DNA in the blood is a noninvasive method that may help detect cancer at early stages if one knows the correct markers for evaluation. Luo et al. analyzed methylation patterns in blood samples from multiple large cohorts of patients, including a prospective screening cohort of people at high risk of colorectal cancer. The authors identified and validated a methylation-based diagnostic score to help distinguish patients with colorectal cancer from healthy controls, as well as a prognostic score that correlated with patients’ survival. One methylation marker in particular appeared to have high sensitivity and specificity for identifying patients with cancer.

But something was amiss. According to the expression of concern

On 1 January 2020, Science Translational Medicine published the Research Article “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer” by H. Luo, Q. Zhao, W. Wei, L. Zheng, S. Yi, G. Li, W. Wang, H. Sheng, H. Pu, H. Mo, Z. Zuo, Z. Liu, C. Li, C. Xie, Z. Zeng, W. Li, X. Hao, Y. Liu, S. Cao, W. Liu, S. Gibson, K. Zhang, G. Xu, R.-h. Xu (1). Subsequently, it was brought to our attention that the methylation status at cg10673833 could not have been measured using the Behavioral Diagnostics assay indicated in the Materials and Methods, because this assay exclusively detects methylation at cg05575921. When Science Translational Medicine queried the authors, they provided a different description of their methods, stating that the primers and probes for their PCR-based assay were custom-designed and ordered from Thermo Fisher Scientific. However, it remains unclear why the erroneous information about the Behavioral Diagnostics assay was presented in the Materials and Methods. Given our continuing concerns about how exactly methylation at cg10673833 was measured—the foundation upon which the results in this Research Article are based—Science Translational Medicine is publishing an Editorial Expression of Concern in addition to an erratum to alert the scientific community to these concerns.  

Rui-Hua Xu, a professor at Sun Yat-sen University Cancer Center, and the corresponding author of the study, denied that anything was wrong with the paper beyond a simple mistake in the provenance of the assay: 

First of all, let me state that our digital droplet PCR assay is valid and there is nothing wrong in our methodology, or reagent materials.

All essential information of our methylation assay on cg10673833, including cell free DNA isolation, bisulfite conversion, the droplet PCR primer sequences and the assay condition, are exactly the same as our initial submission and remains to be effective, as we wrote in the erratum [see below]. 

Xu told us that the researchers used reagents from one company for their initial experiments, then switched: 

We made a mistake of the vendor information when we wrote the paper, we feel very sorry about this mistake in writing this paper but it is an unintentional error. We feel regretful about the decision of EoC but respect STM. We have corrected the vendor information, provided a more detail protocol and released the prime sequences of cg10673833 in the erratum which will be published with EoC simultaneously. We would like to emphasize that our ddPCR assay is robust, and have been reproduced many times. We are happy to supply relevant primers and reagents  to other labs in the world to replicate/confirm our results.

This is the Erratum:

In the Research Article “Circulating tumor DNA methylation profiles enable early diagnosis, prognosis prediction, and screening for colorectal cancer,” the procedure for performing droplet digital PCR was incorrect in the Supplementary Materials and Methods. The original text stated that “an aliquot of each sample was pre-amplified, diluted 1: 3000, and then PCR-amplified using fluorescent, dual-labeled primer-probe sets specific for cg10673833 from Behavioral Diagnostics (available for sale via IBI Scientific, www.ibisci.com) and Universal Digital PCR reagents and protocols from Bio-Rad.” The authors have corrected this text to indicate that “the PCR primers and dual labeled fluorescent probes in the ddPCR assay were as following: forward primer, 5′- GTTTTATAAGGAGGTTGTGTT; reverse primer, 5′-AACIAAAAACCCTCCAAA; probe for methylated allele detection, 5′- FAM/GAGGGGTCGGATGTTGG/BHQ1-3′; and probe for unmethylated allele detection, 5′-HEX/GAGGGGTTGGATGTTGGG/BHQ1-3′. The following cycling conditions were used: 98°C for 10 min, followed by 40 cycles at 98°C for 30 s and 53°C for 60 s, and finally 98°C for 10 min. The primers and probes were custom designed and synthesized by Thermo Fisher Scientific (www.thermofisher.com/cn/en/home/life-science/oligonucleotides-primers-probes-genes/applied-biosystems-custom-primers-probes.html). The ddPCR Supermix for Probes (Cat.18630125) and other universal Digital PCR reagents and protocols were purchased from Bio-Rad (www.bio-rad.com/en-cn/category/digital-pcr?ID=M9HE2R15).” The Supplementary Materials PDF has been corrected.


Like Retraction Watch? You can make a tax-deductible contribution to support our work, follow us on X or Bluesky, like us on Facebook, follow us on LinkedIn, add us to your RSS reader, or subscribe to our daily digest. If you find a retraction that’s not in our database, you can let us know here. For comments or feedback, email us at [email protected].


Leave a Reply

This site uses Akismet to reduce spam. Learn how your comment data is processed.